#WARNING:no index is registered index "YP_009725310.1" in "https://rest.uniprot.org/uniprotkb/" url "https://rest.uniprot.org/uniprotkb/YP_009725310.1.txt".
Please visit the UniProt website(https://www.uniprot.org), and get a proper ID/AC for your query protein.

Summary for the 332-nd Site(W)

PID QueryLength FocusSite TITLE
31190 346 332 W
UniProt Information
AC/IDAC:YP_009725310.1 ID:
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
W:88% F:12% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
7n7u E (beta-strand) e (exposed) 34.7
3D Complex Information
Predicted Bind Molecules
nucleotide:22 compound:24 precipitant:3
Templates for 3D complexes
nucleotide [gu ] 6x1b_A_1_C_1 6x1b_A_2_C_2 6x1b_A_3_C_3 6x1b_B_1_D_1 6x1b_B_2_D_2 6x1b_B_3_D_3 [aua ] 7n06_A_1_G_1 7n06_B_1_H_1 7n06_C_1_I_1 7n06_D_1_J_1 7n06_E_1_K_1 7n06_F_1_L_1 [xxxxxuaguagguuguauaguaguaagaccagacccxxxxxxxxxxxxxxxx ] 7tj2_A_1_G_1 [xxxxxxxxxxxxxxxxgggucuggucuuacuacuauacaaccuacuaxxxxx ] 7tj2_A_1_H_1 [xxxgguaguagguuguauaguaguaagaccagacccxxxxxxxxxxxxxxxx ] 7tqv_A_1_G_1 [xxxxxxxxxxxxxxxxgggucuggucuuacuacuauacaaccuacuaccxxx ] 7tqv_A_1_H_1 [uuuuuuuuuuuuuuuuuxxxxxxxxxxxxxxxxxx ] 8ud3_E_1_G_1 [xxxxxxxxxxxxxxxaaaaaaaaaaaaaaaaaxxx ] 8ud3_E_1_H_1 [uuuuuuuuuuuuuuuuuuuugucxxxxxxxxxxxx ] 8ud4_E_1_G_1 [xxxxxxxxxxxxgacaaaaaaaaaaaaaaaaaaaa ] 8ud4_E_1_H_1 [uuuuuuuuuuuuuuuuuuuugucauucxxxxxxxx ] 8ud5_E_1_G_1 [xxxxxxxxgaaugacaaaaaaaaaaaaaaaaaaaa ] 8ud5_E_1_H_1 compound [WUS ] 5s70_B_4_E_4 5s70_B_5_E_5 5s70_B_6_E_6 [WOY ] 5saf_A_1_D_1 5saf_A_2_D_2 5saf_A_3_D_3 5saf_B_4_E_4 5saf_B_5_E_5 5saf_B_6_E_6 [ZQJ ] 5sah_B_4_D_4 5sah_B_5_D_5 5sah_B_6_D_6 [U3P ] 6x4i_A_1_C_1 6x4i_A_2_C_2 6x4i_A_3_C_3 6x4i_B_1_O_1 6x4i_B_2_O_2 6x4i_B_3_O_3 [VQV ] 7k1o_A_1_D_1 7k1o_A_2_D_2 7k1o_B_1_F_1 7k1o_B_2_F_2 7k1o_C_1_H_1 7k1o_C_2_H_2 precipitant [ACT ] 6wlc_A_1_F_1 6wlc_A_2_F_2 6wlc_A_3_F_3


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]