|
PID | QueryLength | FocusSite | TITLE |
31190 | 346 | 110 K |
AC/ID | AC:YP_009725310.1 ID: |
Percentages of Amino Acids in Homologous Proteins
![]() |
N:30% K:19% L:12% E:9% Q:7% A:3% R:2% D:2% G:2% I:2% P:2% S:2% T:2% V:2% C:1% H:1% M:1% F:1% Y:1% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
![]() |
S (bend) | e (exposed) | 64.2 |
Predicted Bind Molecules |
nucleotide:3 |
Templates for 3D complexes |
nucleotide [xxxxxuaguagguuguauaguaguaagaccagacccxxxxxxxxxxxxxxxx ] ![]() ![]() ![]() |
![]() [Back to SiteTable] |
![]() [Back to Search Page] |
![]() [Back to Top Page] |