#WARNING:no index is registered index "YP_009725310.1" in "https://rest.uniprot.org/uniprotkb/" url "https://rest.uniprot.org/uniprotkb/YP_009725310.1.txt".
Please visit the UniProt website(https://www.uniprot.org), and get a proper ID/AC for your query protein.

Summary for the 110-th Site(K)

PID QueryLength FocusSite TITLE
23668 346 110 K
UniProt Information
AC/IDAC:YP_009725310.1 ID:
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
N:30% K:19% L:12% E:9% Q:7% A:3% R:2% D:2% G:2% I:2% P:2% S:2% T:2% V:2% C:1% H:1% M:1% F:1% Y:1% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
7n7u S (bend) e (exposed) 64.2
3D Complex Information
Predicted Bind Molecules
nucleotide:3
Templates for 3D complexes
nucleotide [xxxxxuaguagguuguauaguaguaagaccagacccxxxxxxxxxxxxxxxx ] 7tj2_E_1_G_1 [xxxgguaguagguuguauaguaguaagaccagacccxxxxxxxxxxxxxxxx ] 7tqv_E_1_G_1 [uuuuuuuuuuuuuuuuuuuugucauucxxxxxxxx ] 8ud5_B_1_G_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]