Summary for the 42-nd Site(L) |
PID | QueryLength | FocusSite | TITLE |
20796 | 198 | 42 L |
AC/ID | AC:YP_009725304.1 ID: |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
M:31% C:22% V:16% A:14% L:11% F:6% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
8gwe | H (alpha-helix) | b (buried) | 17.4 |
Predicted Bind Molecules |
homo:2 nucleotide:1 |
Templates for 3D complexes |
homo [28576:R1AB_CVHSA ] 2ahm_E_1_H_1 2ahm_E_2_H_2 nucleotide [xxxxxxxxxxxxxxxxxxxxxxxagcugcucccuagcaugcuacuaccgxxxxxxxxx ] 7cxn_B_1_F_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |