#WARNING:no index is registered index "YP_009725304.1" in "https://rest.uniprot.org/uniprotkb/" url "https://rest.uniprot.org/uniprotkb/YP_009725304.1.txt".
Please visit the UniProt website(https://www.uniprot.org), and get a proper ID/AC for your query protein.

Summary for the 62-nd Site(M)

PID QueryLength FocusSite TITLE
20796 198 62 M
UniProt Information
AC/IDAC:YP_009725304.1 ID:
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
M:100% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
8gwe H (alpha-helix) e (exposed) 55.1
3D Complex Information
Predicted Bind Molecules
hetero:38 nucleotide:6
Templates for 3D complexes
hetero [94384:R1AB_SARS2 ] 6xez_B_1_F_1 6xez_D_1_E_1 7cxm_B_1_H_1 7cxn_B_1_H_1 7cyq_B_1_H_1 7cyq_D_1_G_1 7egq_B_1_Q_1 7egq_J_1_R_1 7eiz_B_1_J_1 7eiz_D_1_K_1 7krn_D_1_E_1 7kro_B_1_F_1 7rdx_B_1_F_1 7rdx_D_1_E_1 7rdy_B_1_F_1 7rdz_B_1_F_1 7re0_D_1_E_1 7re3_B_1_F_1 7re3_G_1_N_1 8gw1_B_1_H_1 8gw1_D_1_G_1 8gwb_B_1_F_1 8gwb_D_1_E_1 8gwe_B_1_E_1 8gwe_D_1_F_1 8gwf_B_1_H_1 8gwf_D_1_G_1 8gwg_B_1_H_1 8gwg_D_1_G_1 8gwi_B_1_H_1 8gwi_D_1_G_1 8gwk_B_1_H_1 8gwm_B_1_F_1 8gwm_D_1_E_1 8gwn_B_1_H_1 8gwn_D_1_G_1 8gwo_B_1_H_1 8gwo_D_1_G_1 nucleotide [xxxxxxugcuacgcguag ] 6yyt_D_1_G_1 [xxxxxxccccauaacuuaaucucacauagc ] 7ed5_D_1_F_1 [xxxxxxxxxxxxxxxxxuaauagcuucuuaggagaaugacguagcaugcuacgcx ] 7re3_D_1_I_1 7re3_L_1_P_1 [xxxxxxxxxxxxxxxxxxcucagcuucuuaggagaaugacguagcaugcuacgcx ] 7uo4_D_1_F_1 [xxxxxxugacugcucccuagcaugcuacuaccg ] 8gwb_D_1_J_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]