#WARNING:no index is registered index "YP_009725304.1" in "https://rest.uniprot.org/uniprotkb/" url "https://rest.uniprot.org/uniprotkb/YP_009725304.1.txt".
Please visit the UniProt website(https://www.uniprot.org), and get a proper ID/AC for your query protein.

Summary for the 54-th Site(A)

PID QueryLength FocusSite TITLE
20796 198 54 A
UniProt Information
AC/IDAC:YP_009725304.1 ID:
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
A:65% S:35% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
8gwe H (alpha-helix) e (exposed) 30.4
3D Complex Information
Predicted Bind Molecules
homo:4 nucleotide:26
Templates for 3D complexes
homo [28567:R1AB_CVHSA ] 2ahm_G_1_E_1 2ahm_G_2_E_2 2ahm_H_1_F_1 2ahm_H_2_F_2 nucleotide [xgcguagcaugcuacgucauucuccuaagaagcua ] 6xez_B_1_G_1 6xez_D_1_G_1 [gcgguaguagcaugcuagggagcag ] 7cxm_D_1_E_1 7cxn_D_1_E_1 7eiz_D_1_G_1 8gw1_D_1_E_1 8gwb_B_1_I_1 8gwb_D_1_I_1 8gwk_D_1_E_1 8gwm_D_1_H_1 8gwo_B_1_E_1 8gwo_D_1_E_1 [xxxxxxxxgcgguaguagcaugcuagggagcag ] 7cyq_D_1_E_1 [gcuaugugagauuaaguuau ] 7ed5_D_1_E_1 [xxcguagcaugcuacgucauucuccuaagaagcuaccccx ] 7krn_B_1_F_1 7krn_D_1_F_1 7kro_D_1_G_1 7krp_B_1_E_1 7krp_D_1_E_1 [xgcguagcaugcuacgucauucuccuaagaagcug ] 7uo4_D_1_E_1 [xxxguagcaugcuacgucauucuccuaagaagcug ] 7uo7_F_1_D_1 [xxxguagcaugcuacgucauucuccacgcgaagcXxxxx ] 7uo9_F_1_D_1 [xxcguagcaugcuacgucauucuccacgcgaagca ] 7uob_D_1_E_1 7uoe_D_1_E_1 [xxxguagcaugcuacgucauucuccacgcgaagca ] 8sq9_B_1_F_1 8sq9_D_1_F_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]