#WARNING:no index is registered index "YP_009725304.1" in "https://rest.uniprot.org/uniprotkb/" url "https://rest.uniprot.org/uniprotkb/YP_009725304.1.txt".
Please visit the UniProt website(https://www.uniprot.org), and get a proper ID/AC for your query protein.

Summary for the 57-th Site(R)

PID QueryLength FocusSite TITLE
20796 198 57 R
UniProt Information
AC/IDAC:YP_009725304.1 ID:
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
R:62% K:38% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
8gwe H (alpha-helix) e (exposed) 62.1
3D Complex Information
Predicted Bind Molecules
homo:4 nucleotide:20
Templates for 3D complexes
homo [28576:R1AB_CVHSA ] 2ahm_G_1_E_1 2ahm_G_2_E_2 2ahm_H_1_F_1 2ahm_H_2_F_2 nucleotide [xgcguagcaugcuacgucauucuccuaagaagcua ] 6xez_D_1_G_1 7rdx_D_1_G_1 7re0_B_1_G_1 7re1_B_1_G_1 7re1_D_1_G_1 7re2_D_1_F_1 [gcgguaguagcaugcuagggagcag ] 7cxm_D_1_E_1 7cxn_D_1_E_1 8gwe_B_1_I_1 8gwf_B_1_E_1 8gwg_B_1_E_1 8gwi_B_1_E_1 8gwk_B_1_E_1 8gwn_B_1_E_1 [gcuaugugagauuaaguuau ] 7dok_F_1_A_1 7ed5_D_1_E_1 [xxxxxgacgauguucgacgauguucgacgacaca ] 7dte_D_1_F_1 [xxcguagcaugcuacgucauucuccuaagaagcuaccccx ] 7krn_D_1_F_1 [xxxguagcaugcuacgucauucuccacgcgaagcXxxxx ] 7uo9_F_1_D_1 [xxcguagcaugcuacgucauucuccacgcgaagca ] 7uob_D_1_E_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]