#WARNING:no index is registered index "YP_009725304.1" in "https://rest.uniprot.org/uniprotkb/" url "https://rest.uniprot.org/uniprotkb/YP_009725304.1.txt".
Please visit the UniProt website(https://www.uniprot.org), and get a proper ID/AC for your query protein.

Summary for the 55-th Site(M)

PID QueryLength FocusSite TITLE
20796 198 55 M
UniProt Information
AC/IDAC:YP_009725304.1 ID:
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
V:70% T:19% M:11% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
8gwe H (alpha-helix) e (exposed) 56.0
3D Complex Information
Predicted Bind Molecules
hetero:7 homo:4 nucleotide:1
Templates for 3D complexes
hetero [94973:R1AB_SARS2 ] 7egq_B_1_Q_1 7eiz_B_1_J_1 7rdx_B_1_F_1 7rdy_B_1_F_1 7rdz_B_1_F_1 8gwb_B_1_F_1 8gwb_D_1_E_1 homo [28576:R1AB_CVHSA ] 2ahm_G_1_E_1 2ahm_G_2_E_2 2ahm_H_1_F_1 2ahm_H_2_F_2 nucleotide [gcgguaguagcaugcuagggagcag ] 8gw1_B_1_E_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]