#WARNING:no index is registered index "YP_009725304.1" in "https://rest.uniprot.org/uniprotkb/" url "https://rest.uniprot.org/uniprotkb/YP_009725304.1.txt".
Please visit the UniProt website(https://www.uniprot.org), and get a proper ID/AC for your query protein.

Summary for the 39-th Site(K)

PID QueryLength FocusSite TITLE
20796 198 39 K
UniProt Information
AC/IDAC:YP_009725304.1 ID:
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
K:31% R:26% Q:16% E:16% T:11% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
8gwe H (alpha-helix) b (buried) 19.8
3D Complex Information
Predicted Bind Molecules
nucleotide:9
Templates for 3D complexes
nucleotide [xxxxxxxxxxxxxxxxxxxxxxxagcugcucccuagcaugcuacuaccgxxxxxxxxx ] 7cxm_D_1_F_1 [xxxxxxxxxxxxxxxxxxxxxxxugacugcucccuagcaugcuacuaccgxxxxxxxxx ] 7cyq_D_1_F_1 [xxxxxxxxxxxxxxxxxxxcuccugugucgucgaacaucgucgaacaucgucxxxxx ] 7dte_B_1_E_1 [aaugucugacugcucccuagcaugcuacuaccg ] 7egq_D_1_T_1 [agcugcucccuagcaugcuacuaccg ] 8gw1_D_1_F_1 [xxxxxxugacugcucccuagcaugcuacuaccg ] 8gwb_B_1_J_1 8gwb_D_1_J_1 8gwn_B_1_F_1 8gwo_B_1_F_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]