|
PID | QueryLength | FocusSite | TITLE |
20796 | 198 | 39 K |
AC/ID | AC:YP_009725304.1 ID: |
Percentages of Amino Acids in Homologous Proteins
![]() |
K:31% R:26% Q:16% E:16% T:11% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
![]() |
H (alpha-helix) | b (buried) | 19.8 |
Predicted Bind Molecules |
nucleotide:9 |
Templates for 3D complexes |
nucleotide [xxxxxxxxxxxxxxxxxxxxxxxagcugcucccuagcaugcuacuaccgxxxxxxxxx ] ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() |
![]() [Back to SiteTable] |
![]() [Back to Search Page] |
![]() [Back to Top Page] |