#WARNING:no index is registered index "YP_009725307.1" in "https://rest.uniprot.org/uniprotkb/" url "https://rest.uniprot.org/uniprotkb/YP_009725307.1.txt".
Please visit the UniProt website(https://www.uniprot.org), and get a proper ID/AC for your query protein.

Summary for the 553-rd Site(R)

PID QueryLength FocusSite TITLE
1989388 932 553 R
UniProt Information
AC/IDAC:YP_009725307.1 ID:
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
R:70% K:30% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
8gwk (coil) e (exposed) 58.1
3D Complex Information
Predicted Bind Molecules
nucleotide:3 compound:6 precipitant:3
Templates for 3D complexes
nucleotide [xxcguagcaugcuacgucauucuccuaagaagcuaccccx ] 7krn_A_1_F_1 7kro_A_1_G_1 7krp_A_1_E_1 compound [GE6 ] 7ctt_A_1_J_1 [H3U ] 7d4f_D_1_H_1 [AT9 ] 7ed5_A_1_K_1 [GTP ] 7uob_A_1_L_1 [CTP ] 7uoe_A_1_K_1 [WSB ] 8sq9_A_1_L_1 precipitant [POP ] 7bv2_A_1_H_1 7dfg_C_1_J_1 7doi_A_1_I_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]