#WARNING:no index is registered index "YP_009725307.1" in "https://rest.uniprot.org/uniprotkb/" url "https://rest.uniprot.org/uniprotkb/YP_009725307.1.txt".
Please visit the UniProt website(https://www.uniprot.org), and get a proper ID/AC for your query protein.

Summary for the 499-th Site(D)

PID QueryLength FocusSite TITLE
1989388 932 499 D
UniProt Information
AC/IDAC:YP_009725307.1 ID:
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
D:42% N:25% K:17% P:16% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
8gwk (coil) e (exposed) 48.1
3D Complex Information
Predicted Bind Molecules
nucleotide:22 compound:1
Templates for 3D complexes
nucleotide [xxxxxxxxxxxxxxxuuaaguuau ] 7aap_A_1_E_1 [xxxxccuacgcXgugxxxx ] 7b3c_A_1_D_1 [xxxxxcuacgcagug ] 7b3d_A_1_D_1 7oyg_A_1_D_1 7oyg_F_1_I_1 [xxxxxxxxxgauuaaguuau ] 7bv2_A_1_D_1 [gggagxxxxcuccuccugugucguxxxxx ] 7c2k_A_1_E_1 [xxxxxxacgacacaggXgxxxx ] 7c2k_A_1_F_1 [xxxxuucuccuaagaagcua ] 7ctt_A_1_E_1 [agauuaaguuau ] 7dfg_C_1_A_1 [xxcguagcaugcuacgucauucuccuaagaagcuaccccx ] 7krn_A_1_F_1 7kro_A_1_G_1 7krp_A_1_E_1 [xgcguagcaugcuacgucauucuccuaagaagcua ] 7rdy_A_1_G_1 7rdz_A_1_G_1 7re0_A_1_G_1 7re1_A_1_G_1 7re2_A_1_F_1 7re3_A_1_H_1 7re3_J_1_O_1 [xxxguagcaugcuacgucauucuccacgcgaagcXxxxx ] 7uo9_A_1_D_1 [xxxguagcaugcuacgucauucuccacgcgaagca ] 8sq9_A_1_F_1 compound [GO3 ] 8gy6_A_1_F_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]