#WARNING:no index is registered index "YP_009725307.1" in "https://rest.uniprot.org/uniprotkb/" url "https://rest.uniprot.org/uniprotkb/YP_009725307.1.txt".
Please visit the UniProt website(https://www.uniprot.org), and get a proper ID/AC for your query protein.

Summary for the 623-rd Site(D)

PID QueryLength FocusSite TITLE
1989388 932 623 D
UniProt Information
AC/IDAC:YP_009725307.1 ID:
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
D:100% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
8gwk H (alpha-helix) e (exposed) 37.0
3D Complex Information
Predicted Bind Molecules
nucleotide:6 compound:15 precipitant:1
Templates for 3D complexes
nucleotide [xxxxccuacgcXgugxxxx ] 7b3c_A_1_D_1 [xxxxxxacgacacaggXgxxxx ] 7c2k_A_1_F_1 [xxcguagcaugcuacgucauucuccuaagaagcuaccccx ] 7krn_A_1_F_1 7kro_A_1_G_1 7krp_A_1_E_1 [cuaagaagcuauuXXXXxxxxxxxxxxxxxxxx ] 7l1f_A_1_D_1 compound [GE6 ] 7aap_A_1_M_1 7ctt_A_1_J_1 [F86 ] 7bv2_A_1_K_1 [1RP ] 7dfg_C_1_G_1 [RVP ] 7dfh_A_1_N_1 [HCU ] 7doi_A_1_O_1 7dok_C_1_G_1 [AT9 ] 7ed5_A_1_K_1 [NWX ] 7uo4_A_1_G_1 [ATP ] 7uo7_A_1_G_1 [UTP ] 7uo9_A_1_J_1 [GTP ] 7uob_A_1_L_1 [CTP ] 7uoe_A_1_K_1 [WSB ] 8sq9_A_1_L_1 [VSN ] 8sqk_A_1_I_1 precipitant [POP ] 7bv2_A_1_H_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]