#WARNING:no index is registered index "YP_009725307.1" in "https://rest.uniprot.org/uniprotkb/" url "https://rest.uniprot.org/uniprotkb/YP_009725307.1.txt".
Please visit the UniProt website(https://www.uniprot.org), and get a proper ID/AC for your query protein.

Summary for the 758-th Site(L)

PID QueryLength FocusSite TITLE
1989388 932 758 L
UniProt Information
AC/IDAC:YP_009725307.1 ID:
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
L:96% F:4% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
8gwk E (beta-strand) e (exposed) 29.8
3D Complex Information
Predicted Bind Molecules
nucleotide:30 compound:3
Templates for 3D complexes
nucleotide [xgcguagcaugcuacgucauucuccuaagaagcua ] 6xez_A_1_G_1 7rdx_A_1_G_1 7rdy_A_1_G_1 7rdz_A_1_G_1 7re0_A_1_G_1 7re1_A_1_G_1 7re2_A_1_F_1 7re3_A_1_H_1 7re3_J_1_O_1 [xxgggccca ] 6xqb_A_1_E_1 [xxxxcaugcuacgcguag ] 6yyt_A_1_E_1 [xxxxxxxxxxxxxxxuuaaguuau ] 7aap_A_1_E_1 [xxxxccuacgcXgugxxxx ] 7b3c_A_1_D_1 [xxxxxcuacgcagug ] 7b3d_A_1_D_1 7oyg_A_1_D_1 7oyg_F_1_I_1 [xxxxxxacgacacaggXgxxxx ] 7c2k_A_1_F_1 [xxxxuucuccuaagaagcua ] 7ctt_A_1_E_1 [xxxxxgacgauguucgacgauguucgacgacaca ] 7dte_A_1_F_1 [cuaagaagcuauuXXXXxxxxxxxxxxxxxxxx ] 7l1f_A_1_D_1 [xxxxxxxxxxxxxxxxxxxxxxcuacgcagua ] 7ozu_A_1_D_1 [xxxxxxxxxxxxxxxxxxxxxxcuacgcagug ] 7ozv_A_1_D_1 [gcgguaguagcaugcuagggagcag ] 8gwb_A_1_I_1 8gwe_A_1_I_1 8gwf_A_1_E_1 8gwg_A_1_E_1 8gwi_A_1_E_1 [xxxxxagcaugcuacgucauucuccacgcgaagcaug ] 8sqj_A_1_F_1 [agcaugcuacgucauucuccacgcgaagcaug ] 8sqk_A_1_F_1 [xxxxxxxxxxxxxagcuauuaaaaucacagauu ] 8urb_A_1_E_1 compound [H3U ] 7d4f_D_1_G_1 [AT9 ] 7ed5_A_1_N_1 [L2B ] 7uoe_A_1_L_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]