#WARNING:no index is registered index "YP_009725307.1" in "https://rest.uniprot.org/uniprotkb/" url "https://rest.uniprot.org/uniprotkb/YP_009725307.1.txt".
Please visit the UniProt website(https://www.uniprot.org), and get a proper ID/AC for your query protein.

Summary for the 688-th Site(A)

PID QueryLength FocusSite TITLE
1989388 932 688 A
UniProt Information
AC/IDAC:YP_009725307.1 ID:
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
A:74% S:26% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
8gwf H (alpha-helix) e (exposed) 28.6
3D Complex Information
Predicted Bind Molecules
nucleotide:3 compound:1
Templates for 3D complexes
nucleotide [cuaagaagcuauuXXXXxxxxxxxxxxxxxxxx ] 7l1f_A_1_D_1 [xgcguagcaugcuacgucauucuccuaagaagcug ] 7uo4_A_1_E_1 [xxxguagcaugcuacgucauucuccuaagaagcug ] 7uo7_A_1_D_1 compound [NWX ] 7uo4_A_1_G_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]