Summary for the 589-th Site(I) |
PID | QueryLength | FocusSite | TITLE |
1989388 | 932 | 589 I |
AC/ID | AC:YP_009725307.1 ID: |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
I:74% L:17% F:9% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
8gwf | T (Hbond turn) | b (buried) | 14.0 |
Predicted Bind Molecules |
nucleotide:6 |
Templates for 3D complexes |
nucleotide [gugggcccx ] 6xqb_A_1_F_1 [xxxxxxugcaucgcguagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 7b3b_A_1_E_1 [aaugucugacugcucccuagcaugcuacuaccg ] 7egq_A_1_T_1 7egq_I_1_V_1 [gguugugauuuuaauagcuu ] 8g6r_A_1_E_1 [xxxxxxxxxxxxxxxxxxxaaaaaucugugauuuuaauagxxxxxxxxxxxxxxx ] 8urb_A_1_F_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |