Summary for the 551-st Site(K) |
PID | QueryLength | FocusSite | TITLE |
1989388 | 932 | 551 K |
AC/ID | AC:YP_009725307.1 ID: |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
K:87% N:13% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
8gwf | S (bend) | e (exposed) | 62.3 |
Predicted Bind Molecules |
hetero:1 nucleotide:3 compound:3 precipitant:3 |
Templates for 3D complexes |
hetero [17482:R1AB_SARS2 ] 7krp_A_1_C_1 nucleotide [xxcguagcaugcuacgucauucuccuaagaagcuaccccx ] 7krn_A_1_F_1 7kro_A_1_G_1 7krp_A_1_E_1 compound [H3U ] 7d4f_D_1_H_1 [NWX ] 7uo4_A_1_G_1 [CTP ] 7uoe_A_1_K_1 precipitant [POP ] 7dfg_C_1_J_1 7doi_A_1_I_1 7dok_C_1_K_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |