#WARNING:no index is registered index "YP_009725307.1" in "https://rest.uniprot.org/uniprotkb/" url "https://rest.uniprot.org/uniprotkb/YP_009725307.1.txt".
Please visit the UniProt website(https://www.uniprot.org), and get a proper ID/AC for your query protein.

Summary for the 546-th Site(Y)

PID QueryLength FocusSite TITLE
1989388 932 546 Y
UniProt Information
AC/IDAC:YP_009725307.1 ID:
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
Y:38% K:26% F:23% V:13% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
8gwf (coil) e (exposed) 38.7
3D Complex Information
Predicted Bind Molecules
nucleotide:2
Templates for 3D complexes
nucleotide [xxxxxxxxxxxxxxxxxucaugcuucgcguggagaaugacguagcaugcuacxxx ] 7uo9_A_1_E_1 [gguugugauuuuaauagcuu ] 8g6r_A_1_E_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]