#WARNING:no index is registered index "YP_009725307.1" in "https://rest.uniprot.org/uniprotkb/" url "https://rest.uniprot.org/uniprotkb/YP_009725307.1.txt".
Please visit the UniProt website(https://www.uniprot.org), and get a proper ID/AC for your query protein.

Summary for the 544-th Site(L)

PID QueryLength FocusSite TITLE
1989388 932 544 L
UniProt Information
AC/IDAC:YP_009725307.1 ID:
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
L:64% N:13% T:13% K:10% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
8gwf E (beta-strand) b (buried) 16.9
3D Complex Information
Predicted Bind Molecules
nucleotide:4
Templates for 3D complexes
nucleotide [aaugucugacugcucccuagcaugcuacuaccg ] 7egq_A_1_T_1 [xxxxxxxxxxxxxxxxxucaugcuucgcguggagaaugacguagcaugcuacxxx ] 7uo9_A_1_E_1 8sq9_A_1_G_1 [gguugugauuuuaauagcuu ] 8g6r_A_1_E_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]