Summary for the 511-st Site(K) |
PID | QueryLength | FocusSite | TITLE |
1989388 | 932 | 511 K |
AC/ID | AC:YP_009725307.1 ID: |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
K:38% T:26% D:13% Q:13% V:10% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
8gwf | (coil) | e (exposed) | 50.0 |
Predicted Bind Molecules |
nucleotide:16 |
Templates for 3D complexes |
nucleotide [xxxxxxugcacugcguagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 7b3d_A_1_E_1 7oyg_A_1_E_1 7oyg_F_1_J_1 [xxxxxxxxxxxxxxxxxxxxxxxugacugcucccuagcaugcuacuaccgxxxxxxxxx ] 7cyq_A_1_F_1 [aaugucugacugcucccuagcaugcuacuaccg ] 7egq_A_1_T_1 7egq_I_1_V_1 [ggXacugcguagxxxxxxxxxxxxxxxxxxxxxxxxx ] 7ozu_A_1_E_1 [xxxxxxxxaugugauuuuaauagcuucuuaggagaaugacguagcaugcuacgcx ] 7rdx_A_1_H_1 [xxxxxxxxxxxxxxxxxuaauagcuucuuaggagaaugacguagcaugcuacgcx ] 7rdz_A_1_H_1 7re0_A_1_H_1 7re2_A_1_G_1 7re3_A_1_I_1 7re3_J_1_P_1 [xxxxxxxxxxxxxxxxxucaugcuucgcguggagaaugacguagcaugcuacxxx ] 7uo9_A_1_E_1 8sq9_A_1_G_1 [gguugugauuuuaauagcuu ] 8g6r_A_1_E_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |