#WARNING:no index is registered index "YP_009725307.1" in "https://rest.uniprot.org/uniprotkb/" url "https://rest.uniprot.org/uniprotkb/YP_009725307.1.txt".
Please visit the UniProt website(https://www.uniprot.org), and get a proper ID/AC for your query protein.

Summary for the 511-st Site(K)

PID QueryLength FocusSite TITLE
1989388 932 511 K
UniProt Information
AC/IDAC:YP_009725307.1 ID:
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
K:38% T:26% D:13% Q:13% V:10% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
8gwf (coil) e (exposed) 50.0
3D Complex Information
Predicted Bind Molecules
nucleotide:16
Templates for 3D complexes
nucleotide [xxxxxxugcacugcguagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 7b3d_A_1_E_1 7oyg_A_1_E_1 7oyg_F_1_J_1 [xxxxxxxxxxxxxxxxxxxxxxxugacugcucccuagcaugcuacuaccgxxxxxxxxx ] 7cyq_A_1_F_1 [aaugucugacugcucccuagcaugcuacuaccg ] 7egq_A_1_T_1 7egq_I_1_V_1 [ggXacugcguagxxxxxxxxxxxxxxxxxxxxxxxxx ] 7ozu_A_1_E_1 [xxxxxxxxaugugauuuuaauagcuucuuaggagaaugacguagcaugcuacgcx ] 7rdx_A_1_H_1 [xxxxxxxxxxxxxxxxxuaauagcuucuuaggagaaugacguagcaugcuacgcx ] 7rdz_A_1_H_1 7re0_A_1_H_1 7re2_A_1_G_1 7re3_A_1_I_1 7re3_J_1_P_1 [xxxxxxxxxxxxxxxxxucaugcuucgcguggagaaugacguagcaugcuacxxx ] 7uo9_A_1_E_1 8sq9_A_1_G_1 [gguugugauuuuaauagcuu ] 8g6r_A_1_E_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]