|
PID | QueryLength | FocusSite | TITLE |
1989388 | 932 | 593 K |
AC/ID | AC:YP_009725307.1 ID: |
Percentages of Amino Acids in Homologous Proteins
![]() |
K:100% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
![]() |
S (bend) | e (exposed) | 22.6 |
Predicted Bind Molecules |
nucleotide:6 compound:1 |
Templates for 3D complexes |
nucleotide [xgcguagcaugcuacgucauucuccuaagaagcua ] ![]() ![]() ![]() ![]() ![]() ![]() ![]() |
![]() [Back to SiteTable] |
![]() [Back to Search Page] |
![]() [Back to Top Page] |