Summary for the 141-st Site(P) |
PID | QueryLength | FocusSite | TITLE |
19863 | 527 | 141 P |
AC/ID | AC:YP_009725309.1 ID: |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
P:100% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
7egq | (coil) | b (buried) | 15.5 |
Predicted Bind Molecules |
nucleotide:5 |
Templates for 3D complexes |
nucleotide [xxxxxxxxxuccuaagaagcuauuaaaaucacc ] 7n0c_B_1_D_1 [xxxxxxxxcuauuaaaaucacc ] 7n0d_B_1_F_1 7n0d_I_1_M_1 [ccccc ] 7n0d_D_1_G_1 7n0d_K_1_N_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |