#WARNING:no index is registered index "YP_009725307.1" in "https://rest.uniprot.org/uniprotkb/" url "https://rest.uniprot.org/uniprotkb/YP_009725307.1.txt".
Please visit the UniProt website(https://www.uniprot.org), and get a proper ID/AC for your query protein.

Summary for the 560-th Site(V)

PID QueryLength FocusSite TITLE
19566 932 560 V
UniProt Information
AC/IDAC:YP_009725307.1 ID:
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
V:44% T:30% C:15% S:12% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
8gwe (coil) b (buried) 9.3
3D Complex Information
Predicted Bind Molecules
nucleotide:3
Templates for 3D complexes
nucleotide [xxxxxxxuuuauaacuuaaucxxxxxxxxx ] 7bv2_A_1_E_1 [xxxxxxxxxxxxxxxxxxcucagcuucuuaggagaaugacguagcaugcuacgcx ] 7uo4_A_1_F_1 [xxxxxxxxxxxxxxxxxxcucagcuucuuaggagaaugacguagcaugcuacxxx ] 7uo7_A_1_E_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]