|
PID | QueryLength | FocusSite | TITLE |
19566 | 932 | 855 M |
AC/ID | AC:YP_009725307.1 ID: |
Percentages of Amino Acids in Homologous Proteins
![]() |
M:61% L:32% V:6% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
![]() |
T (Hbond turn) | e (exposed) | 20.8 |
Predicted Bind Molecules |
nucleotide:19 |
Templates for 3D complexes |
nucleotide [xxxxxxxxgcgguaguagcaugcuagggagcag ] ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() |
![]() [Back to SiteTable] |
![]() [Back to Search Page] |
![]() [Back to Top Page] |