Summary for the 565-th Site(T) |
PID | QueryLength | FocusSite | TITLE |
19566 | 932 | 565 T |
AC/ID | AC:YP_009725307.1 ID: |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
T:44% S:38% A:18% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
8gwk | H (alpha-helix) | b (buried) | 16.9 |
Predicted Bind Molecules |
nucleotide:2 |
Templates for 3D complexes |
nucleotide [xxxxxxxxxxxxxxxxxuaauagcuucuuaggagaaugacguagcaugcuacgcx ] 7re0_A_1_H_1 7re1_A_1_H_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |