Summary for the 686-th Site(T) |
PID | QueryLength | FocusSite | TITLE |
19566 | 932 | 686 T |
AC/ID | AC:YP_009725307.1 ID: |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
T:59% I:16% R:13% V:10% S:3% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
8gwf | T (Hbond turn) | b (buried) | 0.0 |
Predicted Bind Molecules |
nucleotide:12 |
Templates for 3D complexes |
nucleotide [gugggcccx ] 6xqb_A_1_F_1 [xxxxxxxxxxxxxxxxxxxxxxxagcugcucccuagcaugcuacuaccgxxxxxxxxx ] 7cxn_A_1_F_1 [xxxxxxxxxxxxxxxxxxxxxxxugacugcucccuagcaugcuacuaccgxxxxxxxxx ] 7cyq_A_1_F_1 [aaugucugacugcucccuagcaugcuacuaccg ] 7egq_A_1_T_1 7egq_I_1_V_1 [xxxxxxxxaugugauuuuaauagcuucuuaggagaaugacguagcaugcuacgcx ] 7rdx_A_1_H_1 [xxxxxcccauguxxxxxuaauagcuucuuaggagaaugacguagcaugcuacgcx ] 7rdy_A_1_H_1 [xxxxxxxxxxxxxxxxxucaugcuucgcguggagaaugacguagcaugcuacxxx ] 7uo9_A_1_E_1 8sq9_A_1_G_1 [xxxxxxxxxxxxxxxxgugaugcuucgcguggagaaugacguagcaugcuacgxx ] 7uoe_A_1_F_1 [xxxxxxugacugcucccuagcaugcuacuaccg ] 8gwn_A_1_F_1 [aaaaaucugugauuuuaauagcuucuuaggaga ] 9cpo_A_1_F_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |