Summary for the 583-rd Site(R) |
PID | QueryLength | FocusSite | TITLE |
19566 | 932 | 583 R |
AC/ID | AC:YP_009725307.1 ID: |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
R:38% S:34% A:10% K:10% F:7% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
8gwf | S (bend) | e (exposed) | 58.1 |
Predicted Bind Molecules |
nucleotide:1 |
Templates for 3D complexes |
nucleotide [xxxxxxxxxxxxxxxxxxxcuccugugucgucgaacaucgucgaacaucgucxxxxx ] 7dte_A_1_E_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |