Summary for the 513-rd Site(R) |
PID | QueryLength | FocusSite | TITLE |
19566 | 932 | 513 R |
AC/ID | AC:YP_009725307.1 ID: |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
R:29% D:14% E:14% K:11% T:11% G:9% S:4% A:1% N:1% Q:1% I:1% L:1% F:1% P:1% Y:1% V:1% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
8gwf | H (alpha-helix) | e (exposed) | 45.1 |
Predicted Bind Molecules |
nucleotide:33 |
Templates for 3D complexes |
nucleotide [xgcguagcaugcuacgucauucuccuaagaagcua ] 6xez_A_1_G_1 7rdx_A_1_G_1 7rdy_A_1_G_1 7rdz_A_1_G_1 7re0_A_1_G_1 7re1_A_1_G_1 7re2_A_1_F_1 7re3_A_1_H_1 7re3_J_1_O_1 [xxgggccca ] 6xqb_A_1_E_1 [xxxxcaugcuacgcguag ] 6yyt_A_1_E_1 [xxxxxxxxxxxxxxxuuaaguuau ] 7aap_A_1_E_1 [xxxxxcuacgcgXugxxxx ] 7b3b_A_1_D_1 [xxxxxcuacgcagug ] 7b3d_A_1_D_1 7oyg_A_1_D_1 7oyg_F_1_I_1 [xxxxxxxxxgauuaaguuau ] 7bv2_A_1_D_1 [xxxxuucuccuaagaagcua ] 7ctt_A_1_E_1 [xxxxxxxxgcgguaguagcaugcuagggagcag ] 7cyq_A_1_E_1 [agauuaaguuau ] 7dfg_C_1_A_1 7doi_A_1_D_1 [gcuaugug ] 7dfh_A_1_E_1 [gcuaugugagauuaaguuau ] 7dok_C_1_A_1 7ed5_A_1_E_1 [xxxxxgacgauguucgacgauguucgacgacaca ] 7dte_A_1_F_1 [xxcguagcaugcuacgucauucuccuaagaagcuaccccx ] 7krn_A_1_F_1 7kro_A_1_G_1 7krp_A_1_E_1 [xxxxxxxxxxxxxxxxxxxxxxcuacgcagua ] 7ozu_A_1_D_1 [xxxxxxxxxxxxxxxxxxxxxxcuacgcagug ] 7ozv_A_1_D_1 [xxcguagcaugcuacgucauucuccacgcgaagca ] 7uoe_A_1_E_1 [gcgguaguagcaugcuagggagcag ] 8gw1_A_1_E_1 [ucuccuaagaagcuauuaaaaucacagauu ] 9cpo_A_1_E_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |