Summary for the 485-th Site(S) |
PID | QueryLength | FocusSite | TITLE |
1721357 | 601 | 485 S |
AC/ID | AC:YP_009725308.1 ID: |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
S:39% G:26% R:11% E:11% M:10% N:3% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
6xez | S (bend) | e (exposed) | 95.3 |
Predicted Bind Molecules |
nucleotide:5 compound:2 |
Templates for 3D complexes |
nucleotide [uaaaau ] 7cxm_I_1_G_1 7cxn_I_1_G_1 [xxxxxcccauguxxxxxuaauagcuucuuaggagaaugacguagcaugcuacgxx ] 7krn_E_1_G_1 7kro_E_1_H_1 [xxxxxcccauguxxxxxuaauagcuucuuaggagaaugacguagcaugcuacgcx ] 7rdy_E_1_H_1 compound [VWM ] 5rlz_A_1_C_1 [VXG ] 5rmm_B_1_H_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |