Summary for the 554-th Site(H) |
PID | QueryLength | FocusSite | TITLE |
1721357 | 601 | 554 H |
AC/ID | AC:YP_009725308.1 ID: |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
H:58% F:42% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
7egq | T (Hbond turn) | e (exposed) | 39.3 |
Predicted Bind Molecules |
nucleotide:3 compound:3 |
Templates for 3D complexes |
nucleotide [xxxxxcccauguxxxxxuaauagcuucuuaggagaaugacguagcaugcuacgxx ] 7krn_E_1_G_1 7kro_E_1_H_1 [xxxxxcccauguxxxxxuaauagcuucuuaggagaaugacguagcaugcuacgcx ] 7rdy_E_1_H_1 compound [K2P ] 5rlh_B_1_H_1 [VWM ] 5rlz_A_1_C_1 [VXG ] 5rmm_B_1_H_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |