#WARNING:no index is registered index "YP_009725308.1" in "https://rest.uniprot.org/uniprotkb/" url "https://rest.uniprot.org/uniprotkb/YP_009725308.1.txt".
Please visit the UniProt website(https://www.uniprot.org), and get a proper ID/AC for your query protein.

Summary for the 515-th Site(Y)

PID QueryLength FocusSite TITLE
1721357 601 515 Y
UniProt Information
AC/IDAC:YP_009725308.1 ID:
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
Y:100% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
6xez S (bend) e (exposed) 21.7
3D Complex Information
Predicted Bind Molecules
nucleotide:4 compound:3 precipitant:1
Templates for 3D complexes
nucleotide [uaaaau ] 7cxn_I_1_G_1 [xxxxxcccauguxxxxxuaauagcuucuuaggagaaugacguagcaugcuacgxx ] 7krn_E_1_G_1 7kro_E_1_H_1 [xxxxxcccauguxxxxxuaauagcuucuuaggagaaugacguagcaugcuacgcx ] 7rdy_E_1_H_1 compound [K2P ] 5rlh_B_1_H_1 [VWM ] 5rlz_A_1_C_1 [VXG ] 5rmm_B_1_H_1 precipitant [SO4 ] 5wwp_B_1_K_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]