#WARNING:no index is registered index "YP_009725308.1" in "https://rest.uniprot.org/uniprotkb/" url "https://rest.uniprot.org/uniprotkb/YP_009725308.1.txt".
Please visit the UniProt website(https://www.uniprot.org), and get a proper ID/AC for your query protein.

Summary for the 340-th Site(V)

PID QueryLength FocusSite TITLE
1721357 601 340 V
UniProt Information
AC/IDAC:YP_009725308.1 ID:
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
V:44% T:27% N:11% F:11% I:7% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
7egq S (bend) b (buried) 15.3
3D Complex Information
Predicted Bind Molecules
nucleotide:1
Templates for 3D complexes
nucleotide [aaugucugacugcucccuagcaugcuacuaccg ] 7egq_E_1_T_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]