Summary for the 410-th Site(T) |
PID | QueryLength | FocusSite | TITLE |
1721357 | 601 | 410 T |
AC/ID | AC:YP_009725308.1 ID: |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
T:50% V:17% D:12% Y:11% L:9% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
6xez | T (Hbond turn) | e (exposed) | 51.3 |
Predicted Bind Molecules |
nucleotide:5 compound:1 |
Templates for 3D complexes |
nucleotide [uaaaau ] 7cxm_I_1_G_1 7cxn_I_1_G_1 [xxxxxcccauguxxxxxuaauagcuucuuaggagaaugacguagcaugcuacgxx ] 7krn_E_1_G_1 7kro_E_1_H_1 [xxxxxcccauguxxxxxuaauagcuucuuaggagaaugacguagcaugcuacgcx ] 7rdy_E_1_H_1 compound [VXD ] 5rml_B_1_H_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |