Summary for the 79-th Site(H) |
PID | QueryLength | FocusSite | TITLE |
1590160 | 425 | 79 H | RecName: Full=Mothers against decapentaplegic homolog 3; Short=MAD homolog 3; Short=Mad3; Short=Mothers against DPP homolog 3; Short=hMAD-3;AltName: Full=JV15-2;AltName: Full=SMAD family member 3; Short=SMAD 3; Short=Smad3; Short=hSMAD3; |
AC/ID | AC:P84022 ID:SMAD3_HUMAN |
Feature Table for 79-th site |
VAR_SEQ: /note="Missing (in isoform 3)" /id="VSP_043793" DOMAIN: /note="MH1" VAR_SEQ: /note="Missing (in isoform 4)" /id="VSP_045348" CHAIN: /note="Mothers against decapentaplegic homolog 3" /id="PRO_0000090856" |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
H:35% G:33% F:14% S:10% A:7% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
1ozj | T (Hbond turn) | e (exposed) | 91.6 |
Predicted Bind Molecules |
homo:4 nucleotide:10 precipitant:2 |
Templates for 3D complexes |
homo [31745:SMAD3_HUMAN ] 1ozj_C_1_D_1 1ozj_D_1_C_1 [31440:SMAD5_MOUSE ] 5x6h_A_1_A_2 5x6h_A_2_A_1 nucleotide [tgcaggcgcgcctgcaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 5od6_A_1_D_1 6fzt_A_1_C_1 6fzt_B_2_D_2 6tbz_A_1_B_1 6zmn_A_1_D_2 6zmn_B_1_C_1 [gtatggcgccatacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 5x6h_A_1_B_1 5x6h_A_2_B_2 [atcagactgccggcagtctataxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 5x6m_D_1_B_1 5x6m_H_1_F_1 precipitant [GOL ] 3kmp_A_1_F_1 3kmp_B_1_H_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |