Summary for the 72-nd Site(D)

PID QueryLength FocusSite TITLE
1590160 425 72 D RecName: Full=Mothers against decapentaplegic homolog 3; Short=MAD homolog 3; Short=Mad3; Short=Mothers against DPP homolog 3; Short=hMAD-3;AltName: Full=JV15-2;AltName: Full=SMAD family member 3; Short=SMAD 3; Short=Smad3; Short=hSMAD3;
UniProt Information
AC/IDAC:P84022 ID:SMAD3_HUMAN
Feature Table for 72-th site STRAND:
VAR_SEQ: /note="Missing (in isoform 3)" /id="VSP_043793"
DOMAIN: /note="MH1"
VAR_SEQ: /note="Missing (in isoform 4)" /id="VSP_045348"
CHAIN: /note="Mothers against decapentaplegic homolog 3" /id="PRO_0000090856"
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
D:69% N:15% L:2% A:1% R:1% Q:1% E:1% G:1% I:1% K:1% F:1% P:1% S:1% T:1% Y:1% V:1% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
1ozj T (Hbond turn) e (exposed) 54.9
3D Complex Information
Predicted Bind Molecules
nucleotide:5
Templates for 3D complexes
nucleotide [acgggccgcggcccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 5mf0_A_1_C_1 [gtatggcgccatacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 5x6h_A_1_B_1 5x6h_A_2_B_2 [ttatagactgccggcagtctgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 5x6m_A_1_C_1 5x6m_E_1_G_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]