Summary for the 101-st Site(H) |
PID | QueryLength | FocusSite | TITLE |
1590160 | 425 | 101 H | RecName: Full=Mothers against decapentaplegic homolog 3; Short=MAD homolog 3; Short=Mad3; Short=Mothers against DPP homolog 3; Short=hMAD-3;AltName: Full=JV15-2;AltName: Full=SMAD family member 3; Short=SMAD 3; Short=Smad3; Short=hSMAD3; |
AC/ID | AC:P84022 ID:SMAD3_HUMAN |
Feature Table for 101-th site |
HELIX: VAR_SEQ: /note="Missing (in isoform 3)" /id="VSP_043793" DOMAIN: /note="MH1" VAR_SEQ: /note="Missing (in isoform 4)" /id="VSP_045348" CHAIN: /note="Mothers against decapentaplegic homolog 3" /id="PRO_0000090856" |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
H:35% S:24% N:23% V:10% A:7% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
1ozj | G (3/10-helix) | e (exposed) | 62.3 |
Predicted Bind Molecules |
nucleotide:22 |
Templates for 3D complexes |
nucleotide [tatgtctagactgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 1mhd_C_1_B_1 [gtatgtctagactgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 1ozj_C_1_B_1 [atcagtctagacataxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 3kmp_B_1_C_1 [tgcaggcgcgcctgcaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 5od6_A_1_C_1 6fzs_A_1_D_1 6fzs_B_2_C_2 6fzt_B_2_C_2 6tbz_A_1_C_1 6zmn_B_1_D_1 [tgcaggctagcctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 5odg_A_1_D_1 5odg_A_3_D_3 [atcagtctagacataxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 5x6g_B_1_C_1 [gtatggcgccatacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 5x6h_A_1_B_2 5x6h_A_2_B_1 [atcagactgccggcagtctataxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 5x6m_A_1_B_1 5x6m_E_1_F_1 [ttatagactgccggcagtctgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 5x6m_D_1_C_1 5x6m_H_1_G_1 [gagtgtctgcagacactcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 6h3r_A_1_D_1 6h3r_B_1_C_2 [tgcaggctagcctgcaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ] 6tce_A_1_B_2 6tce_A_2_B_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |