#WARNING:no index is registered index "YP_009725308.1" in "https://rest.uniprot.org/uniprotkb/" url "https://rest.uniprot.org/uniprotkb/YP_009725308.1.txt".
Please visit the UniProt website(https://www.uniprot.org), and get a proper ID/AC for your query protein.

Summary for the 67-th Site(G)
PID QueryLength FocusSite TITLE
13010 601 67 G
UniProt Information
AC/IDAC:YP_009725308.1 ID:
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment] 
G:100%
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
7cxm S (bend) e (exposed) 71.4
3D Complex Information
Predicted Bind Molecules
hetero:16 nucleotide:1 compound:1
Templates for 3D complexes
hetero [28567:R1AB_SARS2 ] 6xez_F_1_B_1 7cxm_H_1_B_1 7cxn_H_1_B_1 7cyq_G_1_D_1 7cyq_H_1_B_1 7krn_E_1_D_1 7kro_E_1_D_1 7kro_F_1_B_1 8gw1_G_1_D_1 8gwb_F_1_B_1 8gwe_E_1_B_1 8gwf_H_1_B_1 8gwg_H_1_B_1 8gwi_H_1_B_1 8gwn_H_1_B_1 8gwo_H_1_B_1 nucleotide [xxxxxxugacugcucccuagcaugcuacuaccg ] 8gwb_E_1_J_1 compound [1N7 ] 7krn_E_1_T_1


[Back to SiteTable]
[Back to Search Page]
[Back to Top Page]