Summary for the 180-th Site(Y) |
PID | QueryLength | FocusSite | TITLE |
13010 | 601 | 180 Y |
AC/ID | AC:YP_009725308.1 ID: |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
Y:65% S:35% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
6xez | S (bend) | e (exposed) | 24.3 |
Predicted Bind Molecules |
nucleotide:4 compound:1 |
Templates for 3D complexes |
nucleotide [uaaaau ] 7cxm_I_1_G_1 [xxxxxcccauguxxxxxuaauagcuucuuaggagaaugacguagcaugcuacgxx ] 7krn_E_1_G_1 [xxxxxxxxaugugauuuuaauagcuucuuaggagaaugacguagcaugcuacgcx ] 7rdx_E_1_H_1 [xxxxxcccauguxxxxxuaauagcuucuuaggagaaugacguagcaugcuacgcx ] 7rdy_E_1_H_1 compound [VXD ] 5rml_B_1_H_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |