Summary for the 482-nd Site(H) |
PID | QueryLength | FocusSite | TITLE |
13010 | 601 | 482 H |
AC/ID | AC:YP_009725308.1 ID: |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
H:29% I:18% V:12% C:11% L:11% Q:10% S:10% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
6xez | (coil) | e (exposed) | 46.6 |
Predicted Bind Molecules |
homo:2 nucleotide:3 compound:1 |
Templates for 3D complexes |
homo [94973:R1AB_SARS2 ] 7nio_A_1_B_1 7nio_B_1_A_1 nucleotide [xxxxxcccauguxxxxxuaauagcuucuuaggagaaugacguagcaugcuacgxx ] 7krn_E_1_G_1 7kro_E_1_H_1 [xxxxxcccauguxxxxxuaauagcuucuuaggagaaugacguagcaugcuacgcx ] 7rdy_E_1_H_1 compound [K2P ] 5rlh_B_1_H_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |