#WARNING:no index is registered index "YP_009725308.1" in "https://rest.uniprot.org/uniprotkb/" url "https://rest.uniprot.org/uniprotkb/YP_009725308.1.txt".
Please visit the UniProt website(https://www.uniprot.org), and get a proper ID/AC for your query protein.

Summary for the 78-th Site(P)

PID QueryLength FocusSite TITLE
13010 601 78 P
UniProt Information
AC/IDAC:YP_009725308.1 ID:
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
Q:28% P:20% R:14% H:14% V:13% K:11% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
6xez S (bend) e (exposed) 96.9
3D Complex Information
Predicted Bind Molecules
hetero:4 nucleotide:1
Templates for 3D complexes
hetero [28576:R1AB_SARS2 ] 7cxm_I_1_D_1 7rdy_E_1_D_1 7rdy_F_1_B_1 8gwb_E_1_D_1 nucleotide [xxxxxxugacugcucccuagcaugcuacuaccg ] 8gwb_E_1_J_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]