Summary for the 69-th Site(K)

PID QueryLength FocusSite TITLE
10705 740 69 K RecName: Full=ATP-dependent RNA helicase DDX1; EC=3.6.4.13 ;AltName: Full=DEAD box protein 1;AltName: Full=DEAD box protein retinoblastoma; Short=DBP-RB;
UniProt Information
AC/IDAC:Q92499 ID:DDX1_HUMAN
Feature Table for 69-th site VAR_SEQ: /note="Missing (in isoform 3)" /id="VSP_055453"
REGION: /note="Necessary for interaction with HNRNPK"
DOMAIN: /note="Helicase ATP-binding"
REGION: /note="Interaction with dsRNA"
REGION: /note="Necessary for interaction with RELA"
CHAIN: /note="ATP-dependent RNA helicase DDX1" /id="PRO_0000054986"
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
K:44% R:10% P:7% N:6% A:5% L:5% S:4% E:3% G:3% Q:2% Y:2% D:1% H:1% I:1% M:1% F:1% V:1% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
8tbx T (Hbond turn) e (exposed) 32.5
3D Complex Information
Predicted Bind Molecules
hetero:1 nucleotide:6
Templates for 3D complexes
hetero [63117:E9Q238_MOUSE ] 7ddx_B_1_A_1 nucleotide [Xggacauauggcuguucgccauuxxxxx ] 7pli_A_1_B_1 7pli_C_1_D_1 7pli_G_1_H_1 7pli_I_1_J_1 [gggaaggguuucgacccuucccaauauggcuguucgccauuu ] 7pmq_C_1_G_1 7pmq_D_1_E_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]