#WARNING:no index is registered index "YP_009725310.1" in "https://rest.uniprot.org/uniprotkb/" url "https://rest.uniprot.org/uniprotkb/YP_009725310.1.txt".
Please visit the UniProt website(https://www.uniprot.org), and get a proper ID/AC for your query protein.

Summary for the 314-th Site(V)

PID QueryLength FocusSite TITLE
835891 346 314 V
UniProt Information
AC/IDAC:YP_009725310.1 ID:
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
V:63% Q:11% K:10% I:8% A:1% R:1% D:1% E:1% G:1% L:1% P:1% S:1% T:1% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
7n7u S (bend) e (exposed) 65.3
3D Complex Information
Predicted Bind Molecules
nucleotide:3 precipitant:21
Templates for 3D complexes
nucleotide [xxxxxxxxxxxxxxxxgggucuggucuuacuacuauacaaccuacuaxxxxx ] 7tj2_A_1_H_1 [xxxxxxxxxxxxgacaaaaaaaaaaaaaaaaaaaa ] 8ud4_E_1_H_1 [xxxxxxxxgaaugacaaaaaaaaaaaaaaaaaaaa ] 8ud5_E_1_H_1 precipitant [ACY ] 6vww_B_1_P_1 6vww_B_2_P_2 6vww_B_3_P_3 [EDO ] 6w01_A_1_F_1 6w01_A_2_F_2 6w01_A_3_F_3 6wlc_A_1_I_1 6wlc_A_2_I_2 6wlc_A_3_I_3 6wxc_A_1_L_1 6wxc_A_2_L_2 6wxc_A_3_L_3 6x4i_A_1_N_1 6x4i_A_2_N_2 6x4i_A_3_N_3 [ACT ] 6wlc_B_1_Q_1 6wlc_B_2_Q_2 6wlc_B_3_Q_3 [FMT ] 6xdh_A_1_F_1 6xdh_A_2_F_2 6xdh_A_4_F_4


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]