#WARNING:no index is registered index "YP_009725310.1" in "https://rest.uniprot.org/uniprotkb/" url "https://rest.uniprot.org/uniprotkb/YP_009725310.1.txt".
Please visit the UniProt website(https://www.uniprot.org), and get a proper ID/AC for your query protein.

Summary for the 344-th Site(K)

PID QueryLength FocusSite TITLE
835891 346 344 K
UniProt Information
AC/IDAC:YP_009725310.1 ID:
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
Q:61% R:23% K:16% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
7n7u (coil) e (exposed) 39.6
3D Complex Information
Predicted Bind Molecules
nucleotide:11 compound:18 precipitant:6
Templates for 3D complexes
nucleotide [gu ] 6x1b_A_1_C_1 6x1b_A_2_C_2 6x1b_A_3_C_3 6x1b_B_1_D_1 6x1b_B_2_D_2 6x1b_B_3_D_3 [xxxgguaguagguuguauaguaguaagaccagacccxxxxxxxxxxxxxxxx ] 7tqv_A_1_G_1 [uuuuuuuuuuuuuuuuuxxxxxxxxxxxxxxxxxx ] 8ud3_E_1_G_1 [uuuuuuuuuuuuuuuuuuuugucxxxxxxxxxxxx ] 8ud4_E_1_G_1 [xxxxxxxxxxxxgacaaaaaaaaaaaaaaaaaaaa ] 8ud4_E_1_H_1 [uuuuuuuuuuuuuuuuuuuugucauucxxxxxxxx ] 8ud5_E_1_G_1 compound [U5P ] 6wlc_A_1_C_1 6wlc_A_2_C_2 6wlc_A_3_C_3 6wlc_B_1_M_1 6wlc_B_2_M_2 6wlc_B_3_M_3 [CMU ] 6wxc_A_1_C_1 6wxc_A_2_C_2 6wxc_A_3_C_3 6wxc_B_1_M_1 6wxc_B_2_M_2 6wxc_B_3_M_3 [UVC ] 7k1l_A_1_C_1 7k1l_A_2_C_2 7k1l_A_3_C_3 7k1l_B_1_H_1 7k1l_B_2_H_2 7k1l_B_3_H_3 precipitant [EDO ] 6x4i_A_1_I_1 6x4i_A_2_I_2 6x4i_A_3_I_3 6x4i_B_1_S_1 6x4i_B_2_S_2 6x4i_B_3_S_3


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]