|
PID | QueryLength | FocusSite | TITLE |
835891 | 346 | 132 D |
AC/ID | AC:YP_009725310.1 ID: |
Percentages of Amino Acids in Homologous Proteins
![]() |
E:70% Q:11% D:10% S:9% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
![]() |
H (alpha-helix) | e (exposed) | 60.5 |
Predicted Bind Molecules |
nucleotide:4 |
Templates for 3D complexes |
nucleotide [xxxxxuaguagguuguauaguaguaagaccagacccxxxxxxxxxxxxxxxx ] ![]() ![]() ![]() ![]() |
![]() [Back to SiteTable] |
![]() [Back to Search Page] |
![]() [Back to Top Page] |