Summary for the 112-nd Site(T) |
PID | QueryLength | FocusSite | TITLE |
835891 | 346 | 112 T |
AC/ID | AC:YP_009725310.1 ID: |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
A:15% N:14% T:14% I:13% D:11% L:4% E:3% G:3% K:3% S:3% V:3% R:2% Q:2% F:2% P:2% C:1% H:1% M:1% W:1% Y:1% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
7n7r | T (Hbond turn) | e (exposed) | 55.2 |
Predicted Bind Molecules |
nucleotide:3 precipitant:3 |
Templates for 3D complexes |
nucleotide [xxxxxuaguagguuguauaguaguaagaccagacccxxxxxxxxxxxxxxxx ] 7tj2_E_1_G_1 [xxxgguaguagguuguauaguaguaagaccagacccxxxxxxxxxxxxxxxx ] 7tqv_E_1_G_1 [uuuuuuuuuuuuuuuuuuuugucauucxxxxxxxx ] 8ud5_B_1_G_1 precipitant [EDO ] 6x1b_B_1_G_1 6x1b_B_2_G_2 6x1b_B_3_G_3 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |