Summary for the 126-th Site(R) |
PID | QueryLength | FocusSite | TITLE |
835891 | 346 | 126 R |
AC/ID | AC:YP_009725310.1 ID: |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
R:68% S:32% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
5sbf | T (Hbond turn) | b (buried) | 18.2 |
Predicted Bind Molecules |
nucleotide:1 compound:3 precipitant:6 |
Templates for 3D complexes |
nucleotide [xxxxxxxxxxxxxxxxgggucuggucuuacuacuauacaaccuacuaccxxx ] 7tqv_C_1_H_1 compound [VWG ] 5sac_B_4_E_4 5sac_B_5_E_5 5sac_B_6_E_6 precipitant [GOL ] 6vww_A_1_D_1 6vww_A_2_D_2 6vww_A_3_D_3 [FMT ] 6xdh_B_1_I_1 6xdh_B_3_I_3 6xdh_B_5_I_5 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |