|
PID | QueryLength | FocusSite | TITLE |
835891 | 346 | 126 R |
AC/ID | AC:YP_009725310.1 ID: |
Percentages of Amino Acids in Homologous Proteins
![]() |
R:68% S:32% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
![]() |
T (Hbond turn) | b (buried) | 19.8 |
Predicted Bind Molecules |
nucleotide:1 compound:3 precipitant:6 |
Templates for 3D complexes |
nucleotide [xxxxxxxxxxxxxxxxgggucuggucuuacuacuauacaaccuacuaccxxx ] ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() |
![]() [Back to SiteTable] |
![]() [Back to Search Page] |
![]() [Back to Top Page] |