Summary for the 132-nd Site(D) |
PID | QueryLength | FocusSite | TITLE |
835891 | 346 | 132 D |
AC/ID | AC:YP_009725310.1 ID: |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
E:70% Q:11% D:10% S:9% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
5sbf | H (alpha-helix) | e (exposed) | 61.7 |
Predicted Bind Molecules |
nucleotide:4 precipitant:6 |
Templates for 3D complexes |
nucleotide [xxxxxuaguagguuguauaguaguaagaccagacccxxxxxxxxxxxxxxxx ] 7tj2_E_1_G_1 [xxxgguaguagguuguauaguaguaagaccagacccxxxxxxxxxxxxxxxx ] 7tqv_E_1_G_1 [uuuuuuuuuuuuuuuuuuuugucauucxxxxxxxx ] 8ud5_B_1_G_1 [xxxxxxxxgaaugacaaaaaaaaaaaaaaaaaaaa ] 8ud5_B_1_H_1 precipitant [SO4 ] 2gti_A_1_D_1 2gti_A_2_D_2 2gti_A_3_D_3 2gti_A_4_D_4 2gti_A_5_D_5 2gti_A_6_D_6 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |