|
PID | QueryLength | FocusSite | TITLE |
835891 | 346 | 135 R |
AC/ID | AC:YP_009725310.1 ID: |
Percentages of Amino Acids in Homologous Proteins
![]() |
T:27% R:20% M:17% L:11% K:11% C:9% S:5% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
![]() |
H (alpha-helix) | e (exposed) | 37.9 |
Predicted Bind Molecules |
nucleotide:3 compound:21 |
Templates for 3D complexes |
nucleotide [xxxxxxxxxxxxxxxxgggucuggucuuacuacuauacaaccuacuaxxxxx ] ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() |
![]() [Back to SiteTable] |
![]() [Back to Search Page] |
![]() [Back to Top Page] |