Summary for the 67-th Site(G) |
PID | QueryLength | FocusSite | TITLE |
8219 | 601 | 67 G |
AC/ID | AC:YP_009725308.1 ID: |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
G:100% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
7cxm | S (bend) | e (exposed) | 71.4 |
Predicted Bind Molecules |
hetero:31 nucleotide:1 compound:6 |
Templates for 3D complexes |
hetero [28576:R1AB_SARS2 ] 6xez_F_1_B_1 7cxm_H_1_B_1 7cxn_H_1_B_1 7cyq_G_1_D_1 7cyq_H_1_B_1 7egq_Q_1_B_1 7egq_R_1_J_1 7krn_E_1_D_1 7kro_E_1_D_1 7kro_F_1_B_1 7rdx_F_1_B_1 7rdy_E_1_D_1 7rdy_F_1_B_1 7rdz_F_1_B_1 7re0_E_1_D_1 7re1_E_1_D_1 7re2_E_1_D_1 7re3_E_1_D_1 7re3_F_1_B_1 7re3_M_1_L_1 7re3_N_1_G_1 8gw1_G_1_D_1 8gwb_F_1_B_1 8gwe_E_1_B_1 8gwf_H_1_B_1 8gwg_H_1_B_1 8gwi_H_1_B_1 8gwn_H_1_B_1 8gwo_H_1_B_1 [92365:R1AB_SARS2 ] 7egq_E_1_P_1 7egq_M_1_H_1 nucleotide [xxxxxxugacugcucccuagcaugcuacuaccg ] 8gwb_E_1_J_1 compound [1N7 ] 7krn_E_1_T_1 7rdx_E_1_U_1 7rdy_E_1_O_1 7re2_E_1_T_1 7re3_E_1_AA_1 7re3_M_1_RA_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |