#WARNING:no index is registered index "YP_009725308.1" in "https://rest.uniprot.org/uniprotkb/" url "https://rest.uniprot.org/uniprotkb/YP_009725308.1.txt".
Please visit the UniProt website(https://www.uniprot.org), and get a proper ID/AC for your query protein.

Summary for the 365-th Site(E)

PID QueryLength FocusSite TITLE
8219 601 365 E
UniProt Information
AC/IDAC:YP_009725308.1 ID:
Evolutionary Information
Percentages of Amino Acids in Homologous Proteins [show alignment]
E:64% F:13% T:12% R:11% 
3D Structure Information
Template For Monomer predicted SecStr predicted ExpBur Predicted Relative Acc(%)
6xez S (bend) e (exposed) 86.4
3D Complex Information
Predicted Bind Molecules
homo:2 nucleotide:2 compound:2
Templates for 3D complexes
homo [94973:R1AB_SARS2 ] 7re3_F_1_E_1 7re3_N_1_M_1 nucleotide [xxxxxcccauguxxxxxuaauagcuucuuaggagaaugacguagcaugcuacgxx ] 7krn_E_1_G_1 [xxxxxcccauguxxxxxuaauagcuucuuaggagaaugacguagcaugcuacgcx ] 7rdy_E_1_H_1 compound [VWJ ] 5rlv_A_1_D_1 [PK4 ] 5rm4_B_1_H_1


[Back to SiteTable]

[Back to Search Page]

[Back to Top Page]