Summary for the 365-th Site(E) |
PID | QueryLength | FocusSite | TITLE |
8219 | 601 | 365 E |
AC/ID | AC:YP_009725308.1 ID: |
Percentages of Amino Acids in Homologous Proteins [show alignment] |
E:64% F:13% T:12% R:11% |
Template For Monomer | predicted SecStr | predicted ExpBur | Predicted Relative Acc(%) |
6xez | S (bend) | e (exposed) | 86.4 |
Predicted Bind Molecules |
homo:2 nucleotide:2 compound:2 |
Templates for 3D complexes |
homo [94973:R1AB_SARS2 ] 7re3_F_1_E_1 7re3_N_1_M_1 nucleotide [xxxxxcccauguxxxxxuaauagcuucuuaggagaaugacguagcaugcuacgxx ] 7krn_E_1_G_1 [xxxxxcccauguxxxxxuaauagcuucuuaggagaaugacguagcaugcuacgcx ] 7rdy_E_1_H_1 compound [VWJ ] 5rlv_A_1_D_1 [PK4 ] 5rm4_B_1_H_1 |
[Back to SiteTable] |
[Back to Search Page] |
[Back to Top Page] |